mouse monoclonal anti yap (Santa Cruz Biotechnology)
Santa Cruz Biotechnology is a verified supplier 
96
Structured Review
Santa Cruz Biotechnology
mouse monoclonal anti yap
Mouse Monoclonal Anti Yap, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1249 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+anti-yap/YAP+Antibody/pmc12799909-2-0-7
Average 96 stars, based on 1249 article reviews
Mouse Monoclonal Anti Yap, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1249 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+anti-yap/YAP+Antibody/pmc12799909-2-0-7
Average 96 stars, based on 1249 article reviews
mouse monoclonal anti yap - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Western Blot:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with Immunoprecipitation:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with Recombinant:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with Transfection:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with Protease Inhibitor:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with SYBR Green Assay:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with Reverse Transcription Polymerase Chain Reaction:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with Incubation:Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: The primary antibody against YAP was Article Title: Arhgef7 promotes activation of the Hippo pathway core kinase Lats Article Snippet: Samples were then incubated with primary antibodies (mouse anti-YAP 1:300; Santa Cruz sc-101199; or rabbit anti-Flag 1:500, Sigma F7425) in 2% BSA–PBS overnight at 4°C. Article Title: Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Zebrafish: Tg(fli1:EGFP)y1 Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002) N/A Zebrafish: Tg(UAS:GFP) Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008) N/A Zebrafish: Tg(fli1:Gal4FF) Zygmunt et al., 2011 N/A Zebrafish: Tg(huC:GFP) Kwon et al., 2013 N/A Zebrafish: yap1ncv101 This paper N/A Zebrafish: wwtr1ncv114 This paper N/A Zebrafish: amotl2afu45 Agarwala et al., 2015 N/A Oligonucleotides Primers for RT-PCR and qPCR analyses, see Table S1 This paper N/A Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG This paper N/A Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC This paper N/A Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC This paper N/A Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG This paper N/A Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC This paper N/A Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA Gene Tools ZFIN: ZDB-MRPHLNO-041116-4 Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT Gene Tools ZFIN: ZDB-MRPHLNO-100415-2 Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT Gene Tools ZFIN: ZDB-MRPHLNO-100415-4 Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA Gene Tools ZFIN: ZDB-MRPHLNO-060317-4 siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi) This paper; Thermo Fisher N/A Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA) Thermo Fisher Cat#12935300 siRNA targeting WWTR1 (Silencer Select siRNA) Thermo Fisher Cat#4392420 Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA) Thermo Fisher Cat#4390843 siRNA targeting LATS1 (MISSION siRNA) Sigma-Aldrich Cat#SIHK1041 siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA) This paper; Sigma-Aldrich N/A Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control) Sigma-Aldrich Cat#SIC001 siRNA targeting AMOT (SMARTpool) Dharmacon Cat#E-015417 siRNA targeting AMOTL1 (SMARTpool) Dharmacon Cat# E-017595 siRNA targeting AMOTL2 (SMARTpool) Dharmacon Cat#E-013232 Control siRNA for AMOTs siRNAs (Non-target control SMARTpool) Dharmacon Cat#D-001910 Recombinant DNA RCIscript-GoldyTALEN vector Addgene Cat#38142 UAS:EGFP-Yap1-5SA plasmid Chiba et al., 2016 N/A (Continued on next page) e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017 Article Title: Substrate mechanics controls adipogenesis through YAP phosphorylation by dictating cell spreading. Article Snippet: Cells were incubated for 1 h with primary antibodies (mouse anti-YAP (Santa Cruz), mouse anti-vinculin (Sigma), rabbit anti-YAP, rabbit anti-panTEAD, rabbit anti-FABP4 (Cell Signaling Technologies). Article Title: A protein tertiary structure mimetic modulator of the Hippo signalling pathway Article Snippet: Article Title: Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-renewal of Stem Cells Article Snippet: The following Yap antibodies were used: Article Title: Nuclear localization of the transcriptional coactivator YAP is associated with invasive lobular breast cancer Article Snippet: Cell lines grown on glass coverslips were incubated with |